1401 pag mnase epicypher (EpiCypher)

EpiCypher is a verified supplier

EpiCypher manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

EpiCypher 1401 pag mnase epicypher
1401 Pag Mnase Epicypher, supplied by EpiCypher, used in various techniques. Bioz Stars score: 95/100, based on 132 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/paramagnetic+beads+epicypher/CUTANA+Concanavalin+A-Conjugated+Paramagnetic+Beads/pm38301646-734-54-56
Average 95 stars, based on 132 article reviews

1401 pag mnase epicypher - by Bioz Stars, 2026-10

95/100 stars

Images

other:

Article Title: SMARCA4 is a haploinsufficient B cell lymphoma tumor suppressor that fine-tunes centrocyte cell fate decisions.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Raw single ATAC sequencing FASTQ files This paper GSE254908 Raw ATAC-seq FASTQ files This paper GSE254908 Raw RNA-sequencing FASTQ files This paper GSE254908 Gene expression microarray data for primary BL GEO GSE132929 Experimental models: Cell lines Human: Raji cells ATCC CCL-86 Human: HEK293T cells ATCC RRID:CVCL_0063 Experimental models: Organisms/strains Mouse: C57BL/6J The Jackson Laboratory Stock# 000664 Mouse: Cd19cre (B6.129P2(C)- Cd19tm1(cre)Cgn/J) The Jackson Laboratory Stock# 006785 Mouse: AID Cre (B6.129P2-Aicdatm1(cre)Mnz/J) The Jackson Laboratory Stock# 007770 Mouse: CD45.1 (B6.SJL-PtprcaPepcb/Boy) The Jackson Laboratory Stock# 002014 Mouse: Rag1 KO (B6.129S7-Rag1tm1Mom/J) The Jackson Laboratory Stock# 002216 Mouse: R26StopFLMYC (C57BL/6N-Gt (ROSA)26Sortm13(CAG-MYC,-CD2*)Rsky/J) The Jackson Laboratory Stock# 020458 Mouse: GFP-Myc:B6;129-Myctm1Slek/J The Jackson Laboratory Stock#021935 Oligonucleotides gRNA1 for the N-terminal SMARCA4 tagging: TCTGGAGTGGACATCTTCAC This manuscript N/A gRNA2 for the N-terminal SMARCA4 tagging: GTCTGGAGTGGACATCTTCA This manuscript N/A AID-GFP-SMARCA4 N-terminal genotyping Fwd: 5’-CGTCTCCCAAGTTCAAGCGATT-3’ This manuscript N/A AID-GFP-SMARCA4 N-terminal genotyping Rev: 5’-ACATCCAGGGACATGCAAAAGA-3’ This manuscript N/A gRNA1 for knock-in of SMARCA4 point mutation: CAGGACCGAGCCCACCGCAT This manuscript N/A gRNA2 for knock-in of SMARCA4 point mutation: CCGCATCGGGCAGCAGAACG This manuscript N/A Smarca4 mouse genotyping Fwd: 5’—3’ This manuscript N/A Smarca4 mouse genotyping Rev: 5’—3’ This manuscript N/A AID-Cre mouse genotyping common Fwd: 5’- GGACCCAACCCAGGAGGCAGATGT-3’ Robbiani et al.66 N/A AID-Cre mouse genotyping mutant Rev: 5’- CACTCGTTGCATCGACCGGTAATG-3’ Robbiani et al.66 N/A AID-Cre mouse genotyping wildtype Rev: 5’- CCTCTAAGGCTTCGCTGTTATTACCAC-3’ Robbiani et al.66 N/A Myc-KI mouse wildtype Fwd: 5’-CCAAAGTCGCTCTGAGTTGTTATC-3’ Calado et al.25 N/A Myc-KI mouse wildtype Rev: 5’-GAGCGGGAGAAATGGATATG-3’ Calado et al.25 N/A Myc-KI mouse mutant Fwd: 5’-CCAAGAGGGTCAAGTTGGA-3’ Calado et al.25 N/A Myc-KI mouse mutant Rev: 5’-GCAATATGGTGGAAAATAAC-3’ Calado et al.25 N/A GFP-myc mouse common Fwd: 5’- CTGAAAGGGGAGTGGTTCAG-3’ Huang et al.28 N/A GFP-myc mouse wildtype Rev: 5’- ACCGCAACATAGGATGGAGA-3’ Huang et al.28 N/A GFP-myc mouse mutant Rev: 5’- GAACTTCAGGGTCAGCTTGC-3’ Huang et al.28 N/A (Continued on next page) e4 Cancer Cell 42, 605–622.e1–e11, April 8, 2024

Article Title: Antigen-specific T cell responses in SARS-CoV-2 mRNA-vaccinated children.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit IgG An5body, CUTANA CUT&RUN Nega5ve Control EpiCypher 13-0042 An5-Rabbit Secondary An5body for CUTANA ChIC/CUT&Tag Workflows EpiCypher 13-0047 CUTANA E. coli Spike-in DNA EpiCypher 18-1401 Anti-Mouse Secondary Antibody for CUTANA ChIC/CUT&Tag Workflows EpiCypher 13-0048 CUTANA Concanavalin A Conjugated Paramagnetic Beads EpiCypher 21-1401 Histone H3K27ac Antibody, SNAP-ChIP Certified EpiCypher Cat# 13-0045; RRID: AB_2923489 Histone H3K4me1 Antibody, SNAP-ChIP Certified EpiCypher Cat# 13-0040; RRID: AB_2923143 H3K27me3 Monoclonal Antibody (G.299.10), ChIP-Verified ThermoFisher Scientific Cat# MA5-11198; RRID: AB_11000749 Acetyl-Histone H3 (Lys27) Monoclonal Antibody, Unconjugated, Species Reactivity: Human, Host: Mouse / IgG1 ThermoFisherScientific Cat# MA5-23516; RRID: AB_2608307 Chemicals, peptides, and recombinant proteins Deoxyribonuclease I from bovine pancreas Sigma-Aldrich DN25-100MG Collagenase from Clostridium Sigma-Aldrich C9263-500MG Collagenase D Sigma-Aldrich 11088882001 Dispase, neutral protease grade II Roche 4942078001 Trypsin inhibtor from Glycine max (soybean) Sigma-Aldrich T9003-250MG Tamoxifen Sigma-Aldrich T5648-5G Corn oil Sigma-Aldrich C8267-500ML 20% Paraformaldehyde Aqueous Solution, EM Grade Electron Microscopy Sciences 15713-S Histo-Clear II National Diagnostics HS2021GLL EGTA (Ethylene glycol-bis(2-aminoethylether)N,N,N0,N0-tetraacetic acid) Sigma-Aldrich E3889-100G TRIzol LS Reagent Invitrogen 10296028 Recombinant Human TGFalpha R&D Systems 239-A-100 ACK lysing buffer ThermoFisher Scientific A1049201 Caerulein Bachem 4030451.0005 Matrigel Matrix Corning 356231 Dexamethasone Sigma-Aldrich D8893-1MG DAPI (4’,6-Diamidino-2-Phenylindole, Dilactate) ThermoFisher Scientific Cat# D3571, RRID:AB_2307445 TDE1 Tagment DNA Enzyme and TD Buffer Illumina 20034198 Trametinib diet (5mg/kg) Bio-Serv S10136 Zombie Aqua Fixable Viability Kit 100 tests BioLegend 423101 Critical commercial assays Agilent High Sensitivity DNA kit Agilent 5067-4626 MinElute PCR Purification Kit Qiagen 28006 Alcian Blue (pH 2.5) Stain Kit Vector Laboratories H-3501 Agilent RNA 6000 Nano Kit Agilent 5067-1511 Deposited data Raw and analyzed data (scRNA-seq; bulk RNA-seq; ATAC-seq) This paper GEO: GSE198564 (Continued on next page) ll Article Developmental Cell 58, 2959–2973.e1–e7, December 18, 2023 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Rabbit IgG An5body, CUTANA CUT&RUN Nega5ve Control EpiCypher 13-0042 An5-Rabbit Secondary An5body for CUTANA ChIC/CUT&Tag Workflows EpiCypher 13-0047 CUTANA E. coli Spike-in DNA EpiCypher 18-1401 Anti-Mouse Secondary Antibody for CUTANA ChIC/CUT&Tag Workflows EpiCypher 13-0048 CUTANA Concanavalin A Conjugated Paramagnetic Beads EpiCypher 21-1401 Histone H3K27ac Antibody, SNAP-ChIP Certified EpiCypher Cat# 13-0045; RRID: AB_2923489 Histone H3K4me1 Antibody, SNAP-ChIP Certified EpiCypher Cat# 13-0040; RRID: AB_2923143 H3K27me3 Monoclonal Antibody (G.299.10), ChIP-Verified ThermoFisher Scientific Cat# MA5-11198; RRID: AB_11000749 Acetyl-Histone H3 (Lys27) Monoclonal Antibody, Unconjugated, Species Reactivity: Human, Host: Mouse / IgG1 ThermoFisherScientific Cat# MA5-23516; RRID: AB_2608307 Chemicals, peptides, and recombinant proteins Deoxyribonuclease I from bovine pancreas Sigma-Aldrich DN25-100MG Collagenase from Clostridium Sigma-Aldrich C9263-500MG Collagenase D Sigma-Aldrich 11088882001 Dispase, neutral protease grade II Roche 4942078001 Trypsin inhibtor from Glycine max (soybean) Sigma-Aldrich T9003-250MG Tamoxifen Sigma-Aldrich T5648-5G Corn oil Sigma-Aldrich C8267-500ML 20% Paraformaldehyde Aqueous Solution, EM Grade Electron Microscopy Sciences 15713-S Histo-Clear II National Diagnostics HS2021GLL EGTA (Ethylene glycol-bis(2-aminoethylether)N,N,N0,N0-tetraacetic acid) Sigma-Aldrich E3889-100G TRIzol LS Reagent Invitrogen 10296028 Recombinant Human TGFalpha R&D Systems 239-A-100 ACK lysing buffer ThermoFisher Scientific A1049201 Caerulein Bachem 4030451.0005 Matrigel Matrix Corning 356231 Dexamethasone Sigma-Aldrich D8893-1MG DAPI (4’,6-Diamidino-2-Phenylindole, Dilactate) ThermoFisher Scientific Cat# D3571, RRID:AB_2307445 TDE1 Tagment DNA Enzyme and TD Buffer Illumina 20034198 Trametinib diet (5mg/kg) Bio-Serv S10136 Zombie Aqua Fixable Viability Kit 100 tests BioLegend 423101 Critical commercial assays Agilent High Sensitivity DNA kit Agilent 5067-4626 MinElute PCR Purification Kit Qiagen 28006 Alcian Blue (pH 2.5) Stain Kit Vector Laboratories H-3501 Agilent RNA 6000 Nano Kit Agilent 5067-1511 Deposited data Raw and analyzed data (scRNA-seq; bulk RNA-seq; ATAC-seq) This paper GEO: GSE198564 (Continued on next page) ll Article Developmental Cell 58, 2959–2973.e1–e7, December 18, 2023 e2

Article Title: Foxp3 and BATF cooperatively direct cis-regulatory programs and gene expression for effector Treg cell differentiation.
Article Snippet: Article Foxp3 and BATF cooperatively direct cis-regulatory programs and gene expression for effector Treg cell differentiation

Chromatin Immunoprecipitation:

Article Title: A reversible epigenetic memory of inflammatory injury controls lineage plasticity and tumor initiation in the mouse pancreas.
Article Snippet: Article

Recombinant:

Article Title: A reversible epigenetic memory of inflammatory injury controls lineage plasticity and tumor initiation in the mouse pancreas.
Article Snippet: Article

Article Title: Single-nucleus multiomic mapping of m 6 A methylomes and transcriptomes in native populations of cells with sn-m6A-CT.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Guinea Pig Polyclonal anti-Rabbit IgG (H+L) (Secondary Antibody) Novus Biologicals Cat#NBP1-72763; RRID:AB_11024108 Rabbit Polyclonal anti-m6A Synaptic Systems Cat#202003; RRID:AB_2279214 Rabbit Polyclonal anti-m6A Merck Millipore Cat#ABE572-I; RRID:AB_2892214 Chemicals, peptides, and recombinant proteins RiboLock RNase Inhibitor Thermo Scientific Cat#EO0381 cOmplete Protease Inhibitor, EDTA-free Roche Cat#11836170001 pAG-Tn5 (MEA&B loaded) EpiCypher Cat#15-1117 5M Betaine Sigma-Aldrich Cat#B0300-1VL SuperScript IV Reverse Transcriptase Invitrogen Cat#18090010 5X SSIV buffer Invitrogen Cat#18090010 0.1M DTT Invitrogen Cat#18090010 dNTP Mix (25 mM each) Thermo Scientific Cat#R1121 Q5 High-Fidelity 2X Master Mix NEB Cat#M0492S Concanavalin A Conjugated Paramagnetic Beads EpiCypher Cat#21-1411 SPRIselect Magnetic Beads Beckman Coulter Cat#B23318 Critical commercial assays Chromium Next GEM Single Cell Multiome ATAC + Gene Expression 10X Genomics Cat#1000285 Bioanalyzer High Sensitivity DNA Kit Agilent Technologies Cat#50674626 Deposited data Raw and analyzed data This paper GEO: GSE217256 Bulk mESC miCLIP data Ke et al.28 GEO: GSE86336 Bulk mESC MeRIP-Seq data Chelmicki et al.29 GEO: GSE145315 Bulk mESC MeRIP-Seq data Liu et al. 52 GEO: GSE146465 Bulk mESC MeRIP-Seq data Xu et al.33 GEO: GSE154138 Bulk mESC MeRIP-Seq data Liu et al.53 GEO: GSE133599 Bulk mESC MeRIP-Seq data Batista et al.30 GEO: GSE52662 Bulk MEF miCLIP data Boulias et al. 54 GEO: GSE122948 Bulk HEK293T miCLIP data Garcia-Campos et al.7 GEO: GSE122956 Bulk mESC Ythdf1-3 CLIP-Seq data Lasman et al.38 GEO: GSE148039 Single-cell HEK293T DART-seq data Tegowski et al.17 GEO: GSE180954 Experimental models: Cell lines Mouse : E14 embryonic stem cell ATCC CRL-1821 Mouse : CF1 embryonic fibroblast, irradiated MTI-GlobalStem GSC-6001G Mouse : C57BL/6 embryonic stem cell Laboratory of Jacob H. Hanna N/A Mouse : C57BL/6 embryonic stem cell, Mettl3-/- (KO) Laboratory of Jacob H. Hanna N/A Oligonucleotides See Table S4 for the sequences of DNA oligonucleotides used in m6A-CT experiments This paper N/A (Continued on next page) Molecular Cell 83, 3205–3216.e1–e5, September 7, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms Trim Galore Trim Galore https://github.com/FelixKrueger/ TrimGalore STAR Dobin et al.55 https://github.com/alexdobin/STAR featureCounts Liao et al.56 https://subread.sourceforge.net/ DESeq2 Love et al.57 http://www.bioconductor.org/packages/ release/bioc/html/DESeq2.html deepTools Ramı́rez et al.58 https://github.com/deeptools/deepTools Integrative Genomics Viewer Thorvaldsdóttir et al.59 https://software.broadinstitute.org/ software/igv/ edgeR Robinson et al.60 https://bioconductor.org/packages/ release/bioc/html/edgeR.html Macs2 Macs2 https://pypi.org/project/MACS2/ ChIPseeker Yu et al.61 https://guangchuangyu.github.io/software/ ChIPseeker/ Guitar Cui et al.62 https://bioconductor.org/packages/ release/bioc/html/Guitar.html Homer Heinz et al.64 http://homer.ucsd.edu/homer/ exomePeak2 exomePeak2 https://github.com/ZW-xjtlu/exomePeak2 bedtools Quinlan and Hall.65 https://bedtools.readthedocs.io/en/latest/ GSEA Subramanian et al.66 https://github.com/nungerleider/pyGSEA MeTPeak Cui et al.63 https://github.com/compgenomics/ MeTPeak cellranger Zheng et al.67 https://support.10xgenomics.com/single- cell-gene-expression/software/pipelines/ latest/what-is-cell-ranger Seurat Hao et al.34 https://satijalab.org/seurat/index.html Signac Stuart et al.35 https://stuartlab.org/signac/ SCP SCP https://github.com/zhanghao-njmu/SCP Rmagic van Dijk et al.68 https://github.com/cran/Rmagic Metascape Zhou et al.69 https://metascape.org/ Nebulosa Alquicira-Hernandez and Powell70 https://www.bioconductor.org/packages/ release/bioc/html/Nebulosa.html BioRender BioRender https://biorender.com Other Step by step protocol for m6A-CT This paper See supplemental information

Electron Microscopy:

Article Title: A reversible epigenetic memory of inflammatory injury controls lineage plasticity and tumor initiation in the mouse pancreas.
Article Snippet: Article

Polymerase Chain Reaction:

Article Title: A reversible epigenetic memory of inflammatory injury controls lineage plasticity and tumor initiation in the mouse pancreas.
Article Snippet: Article

Purification:

Article Title: A reversible epigenetic memory of inflammatory injury controls lineage plasticity and tumor initiation in the mouse pancreas.
Article Snippet: Article

Staining:

Article Title: A reversible epigenetic memory of inflammatory injury controls lineage plasticity and tumor initiation in the mouse pancreas.
Article Snippet: Article

RNA Sequencing:

Article Title: A reversible epigenetic memory of inflammatory injury controls lineage plasticity and tumor initiation in the mouse pancreas.
Article Snippet: Article

Review

1401 pag mnase epicypher (EpiCypher)

Structured Review

Images

Related Articles

other:

Transfection:

Electrophoresis:

Gel Extraction:

Sequencing:

Protein-Protein interactions:

Control:

Chromatin Immunoprecipitation:

Recombinant:

Electron Microscopy:

Polymerase Chain Reaction:

Purification:

Staining:

RNA Sequencing:

Protease Inhibitor:

Microelectrode Array:

Reverse Transcription:

Magnetic Beads:

Single Cell:

Gene Expression:

Cross-linking Immunoprecipitation:

Irradiation:

Cell Isolation:

Co-Immunoprecipitation Assay:

Library Quantification:

Microarray:

Similar Products

Image Search Results